Review



bcg moreau genomic dna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Thermo Fisher bcg moreau genomic dna
    Bcg Moreau Genomic Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bcg+moreau+genomic+dna/DNA/pm37623231-92-20-60
    Average 99 stars, based on 1 article reviews
    bcg moreau genomic dna - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Expressing:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Purification:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Recombinant:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Amplification:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Polymerase Chain Reaction:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Plasmid Preparation:

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with Nco I and Xho I and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..

    Article Title: Impact of Genomic Deletion RD16 on the Expression of the Mycobacterium bovis BCG Moreau VapBC47 Toxin-Antitoxin System.
    Article Snippet: .. For cloning, expression and purification of recombinant Rv3407 (rRv3407) containing a C-terminal His-tag, the rv3407 coding region was amplified from BCG Moreau genomic DNA using primers pET-07F (GGCGCCATGGGTGCTACCGTTGGGCTT) and pET-07R (CCGGCTCGAGCTGCTCGTCGCGCATTTC) and the purified 314 bp PCR product was digested with NcoI and XhoI and ligated into pET28a vector DNA, digested with the same enzymes, using T4 DNA ligase ( Thermo Fisher Scientific, Waltham, MA, USA). ..



    Similar Products

    bcg moreau genomic dna  (Thermo Fisher)
    99
    Thermo Fisher bcg moreau genomic dna
    Bcg Moreau Genomic Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bcg+moreau+genomic+dna/DNA/pm37623231-92-20-60
    Average 99 stars, based on 1 article reviews
    bcg moreau genomic dna - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results